{ "resourceType": "DiagnosticReport", "id": "dr-16da6dff04934", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/diagnosticreport" ] }, "contained": [ { "resourceType": "Observation", "id": "rs-5d347a24bc0a4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-region-studied" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "53041-0", "display": "DNA region of interest panel" } ] }, "subject": { "reference": "Patient/HG00403" }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "51959-5", "display": "Range(s) of DNA sequence examined" } ] }, "valueRange": { "low": { "value": 1000000 }, "high": { "value": 1100000 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1000000 }, "high": { "value": 1000265 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1000300 }, "high": { "value": 1000493 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1000557 }, "high": { "value": 1000686 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1000736 }, "high": { "value": 1000804 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1001045 }, "high": { "value": 1001118 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1001184 }, "high": { "value": 1001233 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1001341 }, "high": { "value": 1001356 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1001450 }, "high": { "value": 1001536 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1001587 }, "high": { "value": 1001663 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1001698 }, "high": { "value": 1001772 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1001872 }, "high": { "value": 1001944 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1001979 }, "high": { "value": 1002078 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1002113 }, "high": { "value": 1002178 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1002264 }, "high": { "value": 1002556 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1002639 }, "high": { "value": 1005003 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1005038 }, "high": { "value": 1005363 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1005398 }, "high": { "value": 1005448 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1005483 }, "high": { "value": 1005737 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1005772 }, "high": { "value": 1005892 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1005927 }, "high": { "value": 1006150 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1006199 }, "high": { "value": 1006250 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1006285 }, "high": { "value": 1006288 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1006323 }, "high": { "value": 1006585 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1006620 }, "high": { "value": 1006649 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1006696 }, "high": { "value": 1006771 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1006828 }, "high": { "value": 1006944 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1006979 }, "high": { "value": 1007365 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1007400 }, "high": { "value": 1007849 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1007921 }, "high": { "value": 1008240 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1008300 }, "high": { "value": 1009272 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1009307 }, "high": { "value": 1009469 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1009504 }, "high": { "value": 1009871 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1009948 }, "high": { "value": 1011780 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1011834 }, "high": { "value": 1012219 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1012254 }, "high": { "value": 1012353 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1012461 }, "high": { "value": 1012794 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1012902 }, "high": { "value": 1013342 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1013411 }, "high": { "value": 1013826 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1013861 }, "high": { "value": 1014755 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1014823 }, "high": { "value": 1014885 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1014932 }, "high": { "value": 1015329 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1015375 }, "high": { "value": 1015461 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1015532 }, "high": { "value": 1015633 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1015671 }, "high": { "value": 1015908 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1015961 }, "high": { "value": 1016090 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1016125 }, "high": { "value": 1016216 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1016251 }, "high": { "value": 1016981 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1017029 }, "high": { "value": 1017048 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1017083 }, "high": { "value": 1017412 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1017446 }, "high": { "value": 1017526 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1017561 }, "high": { "value": 1017621 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1017703 }, "high": { "value": 1018116 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1018151 }, "high": { "value": 1019586 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1019634 }, "high": { "value": 1019733 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1019841 }, "high": { "value": 1020003 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1020059 }, "high": { "value": 1020189 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1020254 }, "high": { "value": 1020667 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1020694 }, "high": { "value": 1021110 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1021145 }, "high": { "value": 1021455 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1021493 }, "high": { "value": 1021561 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1021668 }, "high": { "value": 1021897 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1022005 }, "high": { "value": 1022456 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1022491 }, "high": { "value": 1022592 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1022700 }, "high": { "value": 1022951 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1023059 }, "high": { "value": 1023155 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1023263 }, "high": { "value": 1023887 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1023936 }, "high": { "value": 1023978 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1024086 }, "high": { "value": 1024255 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1024314 }, "high": { "value": 1024388 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1024423 }, "high": { "value": 1024443 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1024478 }, "high": { "value": 1024629 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1024708 }, "high": { "value": 1024809 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1024843 }, "high": { "value": 1025004 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1025085 }, "high": { "value": 1025269 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1025313 }, "high": { "value": 1026156 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1026264 }, "high": { "value": 1026559 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1026665 }, "high": { "value": 1027938 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1027984 }, "high": { "value": 1028060 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1028308 }, "high": { "value": 1028422 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1028593 }, "high": { "value": 1028615 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1028674 }, "high": { "value": 1028903 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1028982 }, "high": { "value": 1029075 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1029111 }, "high": { "value": 1029151 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1029233 }, "high": { "value": 1029323 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1029423 }, "high": { "value": 1029489 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1029603 }, "high": { "value": 1029609 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1029764 }, "high": { "value": 1029818 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1029853 }, "high": { "value": 1029882 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1030044 }, "high": { "value": 1030155 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1030278 }, "high": { "value": 1030287 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1031439 }, "high": { "value": 1031450 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1031830 }, "high": { "value": 1031880 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1032016 }, "high": { "value": 1032258 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1032449 }, "high": { "value": 1032530 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1032581 }, "high": { "value": 1032584 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1032885 }, "high": { "value": 1032889 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1033460 }, "high": { "value": 1033462 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1033623 }, "high": { "value": 1033660 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1033735 }, "high": { "value": 1033790 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1033970 }, "high": { "value": 1033987 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1034022 }, "high": { "value": 1034031 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1034364 }, "high": { "value": 1034371 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1035408 }, "high": { "value": 1035420 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1035790 }, "high": { "value": 1035813 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1035840 }, "high": { "value": 1035872 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1036578 }, "high": { "value": 1036731 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1036860 }, "high": { "value": 1036885 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1037046 }, "high": { "value": 1037157 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1037311 }, "high": { "value": 1037329 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1037437 }, "high": { "value": 1037451 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1037488 }, "high": { "value": 1037499 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1037613 }, "high": { "value": 1037710 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1038037 }, "high": { "value": 1038142 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1038228 }, "high": { "value": 1038259 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1038388 }, "high": { "value": 1038407 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1038442 }, "high": { "value": 1038471 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1038579 }, "high": { "value": 1038588 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1038912 }, "high": { "value": 1038920 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1039028 }, "high": { "value": 1039049 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1039192 }, "high": { "value": 1039329 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1039437 }, "high": { "value": 1039541 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1039649 }, "high": { "value": 1039930 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1040068 }, "high": { "value": 1040184 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1040450 }, "high": { "value": 1040472 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1040504 }, "high": { "value": 1040506 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1040621 }, "high": { "value": 1040625 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1040793 }, "high": { "value": 1040835 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1040988 }, "high": { "value": 1041147 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1041301 }, "high": { "value": 1041337 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1042052 }, "high": { "value": 1042452 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1042488 }, "high": { "value": 1042621 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1043288 }, "high": { "value": 1043393 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1043510 }, "high": { "value": 1043868 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1043903 }, "high": { "value": 1044035 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1044101 }, "high": { "value": 1044335 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1044405 }, "high": { "value": 1044431 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1044611 }, "high": { "value": 1044654 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1044731 }, "high": { "value": 1044751 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1044817 }, "high": { "value": 1044834 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1045200 }, "high": { "value": 1045266 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1045342 }, "high": { "value": 1045348 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1045638 }, "high": { "value": 1045657 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1045809 }, "high": { "value": 1045875 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1045973 }, "high": { "value": 1046128 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1046204 }, "high": { "value": 1046324 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1046606 }, "high": { "value": 1046724 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1047007 }, "high": { "value": 1047011 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1047052 }, "high": { "value": 1047101 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1047158 }, "high": { "value": 1047160 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1047277 }, "high": { "value": 1047467 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1047575 }, "high": { "value": 1047644 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1047679 }, "high": { "value": 1047701 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1047767 }, "high": { "value": 1047804 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1047871 }, "high": { "value": 1048012 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1048136 }, "high": { "value": 1048137 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1048328 }, "high": { "value": 1048388 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1048410 }, "high": { "value": 1048467 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1048502 }, "high": { "value": 1048523 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1048577 }, "high": { "value": 1048579 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1048657 }, "high": { "value": 1048714 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1048790 }, "high": { "value": 1049014 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1049079 }, "high": { "value": 1049088 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1049181 }, "high": { "value": 1049593 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1049794 }, "high": { "value": 1049949 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1050100 }, "high": { "value": 1050150 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1050185 }, "high": { "value": 1050261 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1050412 }, "high": { "value": 1050420 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1050455 }, "high": { "value": 1050631 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1050783 }, "high": { "value": 1052836 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1052919 }, "high": { "value": 1053072 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1053119 }, "high": { "value": 1053193 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1053294 }, "high": { "value": 1053324 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1053384 }, "high": { "value": 1053499 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1053542 }, "high": { "value": 1053720 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1053776 }, "high": { "value": 1053973 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1054088 }, "high": { "value": 1054272 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1054497 }, "high": { "value": 1054609 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1054778 }, "high": { "value": 1054846 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1054881 }, "high": { "value": 1054953 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1055070 }, "high": { "value": 1055123 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1055158 }, "high": { "value": 1055187 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1055247 }, "high": { "value": 1055338 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1055411 }, "high": { "value": 1055506 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1055561 }, "high": { "value": 1055650 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1055848 }, "high": { "value": 1056067 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1056137 }, "high": { "value": 1056153 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1056229 }, "high": { "value": 1056505 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1056559 }, "high": { "value": 1056723 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1056758 }, "high": { "value": 1056814 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1056874 }, "high": { "value": 1057953 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1058061 }, "high": { "value": 1058349 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1058459 }, "high": { "value": 1058509 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1058590 }, "high": { "value": 1059047 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1059108 }, "high": { "value": 1059161 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1059264 }, "high": { "value": 1059473 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1059517 }, "high": { "value": 1059588 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1059633 }, "high": { "value": 1059762 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1059823 }, "high": { "value": 1060002 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1060037 }, "high": { "value": 1060169 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1060235 }, "high": { "value": 1060290 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1060341 }, "high": { "value": 1060417 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1060456 }, "high": { "value": 1060793 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1060828 }, "high": { "value": 1060973 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1061030 }, "high": { "value": 1061099 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1061159 }, "high": { "value": 1061399 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1061434 }, "high": { "value": 1061509 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1061544 }, "high": { "value": 1061757 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1061925 }, "high": { "value": 1062183 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1062331 }, "high": { "value": 1062587 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1062750 }, "high": { "value": 1063632 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1063692 }, "high": { "value": 1064293 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1064377 }, "high": { "value": 1064623 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1064730 }, "high": { "value": 1064896 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1064970 }, "high": { "value": 1065021 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1065056 }, "high": { "value": 1065074 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1065190 }, "high": { "value": 1065205 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1065335 }, "high": { "value": 1065428 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1065643 }, "high": { "value": 1066012 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1066047 }, "high": { "value": 1066093 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1066115 }, "high": { "value": 1066447 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1066552 }, "high": { "value": 1066573 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1066631 }, "high": { "value": 1066795 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1066921 }, "high": { "value": 1067006 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1067038 }, "high": { "value": 1067146 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1067254 }, "high": { "value": 1067525 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1067689 }, "high": { "value": 1067989 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1068098 }, "high": { "value": 1068255 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1068300 }, "high": { "value": 1068600 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1068714 }, "high": { "value": 1070314 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1070444 }, "high": { "value": 1070518 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1070565 }, "high": { "value": 1070651 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1071308 }, "high": { "value": 1071366 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1071472 }, "high": { "value": 1071474 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1071582 }, "high": { "value": 1071716 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1071827 }, "high": { "value": 1071844 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1071933 }, "high": { "value": 1072175 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1072307 }, "high": { "value": 1072501 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1072630 }, "high": { "value": 1073564 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1073672 }, "high": { "value": 1073702 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1073737 }, "high": { "value": 1073764 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1073936 }, "high": { "value": 1073958 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1074066 }, "high": { "value": 1074127 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1074162 }, "high": { "value": 1074205 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1074301 }, "high": { "value": 1075508 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1075548 }, "high": { "value": 1075630 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1075668 }, "high": { "value": 1077442 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1077477 }, "high": { "value": 1077549 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1077582 }, "high": { "value": 1077914 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1078022 }, "high": { "value": 1078195 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1078230 }, "high": { "value": 1078322 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1078415 }, "high": { "value": 1078606 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1078641 }, "high": { "value": 1080373 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1080481 }, "high": { "value": 1081098 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1081190 }, "high": { "value": 1081548 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1081601 }, "high": { "value": 1082598 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1082634 }, "high": { "value": 1083048 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1083090 }, "high": { "value": 1083467 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1083603 }, "high": { "value": 1083960 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1083995 }, "high": { "value": 1084491 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1084570 }, "high": { "value": 1084877 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1084912 }, "high": { "value": 1084938 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1084967 }, "high": { "value": 1085274 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1085329 }, "high": { "value": 1086746 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1086787 }, "high": { "value": 1086841 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1086949 }, "high": { "value": 1087096 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1087131 }, "high": { "value": 1087179 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1087219 }, "high": { "value": 1087240 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1087436 }, "high": { "value": 1087473 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1087530 }, "high": { "value": 1087538 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1087637 }, "high": { "value": 1087671 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1087805 }, "high": { "value": 1087820 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1087895 }, "high": { "value": 1087942 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1088036 }, "high": { "value": 1088201 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1088306 }, "high": { "value": 1088310 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1088673 }, "high": { "value": 1088714 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1089092 }, "high": { "value": 1089130 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1089523 }, "high": { "value": 1089549 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1089656 }, "high": { "value": 1089680 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1090133 }, "high": { "value": 1090138 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1090351 }, "high": { "value": 1090427 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1090513 }, "high": { "value": 1090533 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1090998 }, "high": { "value": 1091099 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1091272 }, "high": { "value": 1091345 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1091417 }, "high": { "value": 1092230 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1092338 }, "high": { "value": 1092591 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1092714 }, "high": { "value": 1093824 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1093945 }, "high": { "value": 1094323 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1094376 }, "high": { "value": 1094503 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1094556 }, "high": { "value": 1094950 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1094983 }, "high": { "value": 1095136 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1095285 }, "high": { "value": 1095537 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1095645 }, "high": { "value": 1096801 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1096937 }, "high": { "value": 1097214 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1097323 }, "high": { "value": 1097459 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1097533 }, "high": { "value": 1097566 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1097674 }, "high": { "value": 1097710 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1097790 }, "high": { "value": 1097916 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1098014 }, "high": { "value": 1099038 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1099083 }, "high": { "value": 1099416 } } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "TBD-noCallRegion", "display": "No call region" } ] }, "valueRange": { "low": { "value": 1099509 }, "high": { "value": 1100000 } } } ] }, { "resourceType": "Observation", "id": "dv-3200606eb98d4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1000156 } } } ] }, { "resourceType": "Observation", "id": "dv-58875111fcbe4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1001177 } } } ] }, { "resourceType": "Observation", "id": "dv-e3a089d351fc4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1002434 } } } ] }, { "resourceType": "Observation", "id": "dv-393ecd6d84df4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1002932 } } } ] }, { "resourceType": "Observation", "id": "dv-3e702b54971f4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1003053 } } } ] }, { "resourceType": "Observation", "id": "dv-544193a40e774", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1003629 } } } ] }, { "resourceType": "Observation", "id": "dv-e748c095853f4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1004957 } } } ] }, { "resourceType": "Observation", "id": "dv-97b60ebede6f4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1004980 } } } ] }, { "resourceType": "Observation", "id": "dv-fa623514bf8e4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1006223 } } } ] }, { "resourceType": "Observation", "id": "dv-c7b38dc5dbbd4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1006990 } } } ] }, { "resourceType": "Observation", "id": "dv-9da4b36541e74", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1007203 } } } ] }, { "resourceType": "Observation", "id": "dv-21c6c9d6afa74", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1007432 } } } ] }, { "resourceType": "Observation", "id": "dv-699861f1403f4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1009234 } } } ] }, { "resourceType": "Observation", "id": "dv-74c04a452e8c4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1009478 } } } ] }, { "resourceType": "Observation", "id": "dv-40981df660244", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1010717 } } } ] }, { "resourceType": "Observation", "id": "dv-7f584d631af94", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "GG" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1011088 } } } ] }, { "resourceType": "Observation", "id": "dv-a0fa537759194", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1011095 } } } ] }, { "resourceType": "Observation", "id": "dv-ff18e1cb8ffc4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1014836 } } } ] }, { "resourceType": "Observation", "id": "dv-e1260b4cc1944", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1014864 } } } ] }, { "resourceType": "Observation", "id": "dv-89af751239904", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1015126 } } } ] }, { "resourceType": "Observation", "id": "dv-47ea53c0d23c4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1015257 } } } ] }, { "resourceType": "Observation", "id": "dv-8b7e3d7de98a4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1015551 } } } ] }, { "resourceType": "Observation", "id": "dv-1daa1fbfdce24", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1015817 } } } ] }, { "resourceType": "Observation", "id": "dv-7423d31d77f74", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1017029 } } } ] }, { "resourceType": "Observation", "id": "dv-639c27a037334", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1017170 } } } ] }, { "resourceType": "Observation", "id": "dv-fbc78fc375bd4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1017197 } } } ] }, { "resourceType": "Observation", "id": "dv-61b08dcb75014", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1017341 } } } ] }, { "resourceType": "Observation", "id": "dv-a13f0f4fe0844", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1018144 } } } ] }, { "resourceType": "Observation", "id": "dv-4b5a3030ac644", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1018562 } } } ] }, { "resourceType": "Observation", "id": "dv-2ae2224e99e94", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1018704 } } } ] }, { "resourceType": "Observation", "id": "dv-11b797f89e3f4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1019175 } } } ] }, { "resourceType": "Observation", "id": "dv-03e764a619544", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1019180 } } } ] }, { "resourceType": "Observation", "id": "dv-11e33402a10e4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1020406 } } } ] }, { "resourceType": "Observation", "id": "dv-97ac8f8d14a04", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "AG" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1020923 } } } ] }, { "resourceType": "Observation", "id": "dv-6f740688b0214", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1021346 } } } ] }, { "resourceType": "Observation", "id": "dv-c0aa6bdf40bf4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1021415 } } } ] }, { "resourceType": "Observation", "id": "dv-7a3934afafe94", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1021583 } } } ] }, { "resourceType": "Observation", "id": "dv-993bfee3795b4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1021695 } } } ] }, { "resourceType": "Observation", "id": "dv-f742a271defc4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1022037 } } } ] }, { "resourceType": "Observation", "id": "dv-a4b6a61c9c584", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1023444 } } } ] }, { "resourceType": "Observation", "id": "dv-aa7f058812794", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1025301 } } } ] }, { "resourceType": "Observation", "id": "dv-b57f9bb6a23a4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "CC" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "AC" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1026707 } } } ] }, { "resourceType": "Observation", "id": "dv-2882112c295a4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1026801 } } } ] }, { "resourceType": "Observation", "id": "dv-1d2ed1293f524", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "CT" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1029471 } } } ] }, { "resourceType": "Observation", "id": "dv-de74422f2aad4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1031540 } } } ] }, { "resourceType": "Observation", "id": "dv-c92e96f139024", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1032165 } } } ] }, { "resourceType": "Observation", "id": "dv-66c24692a5cf4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1032184 } } } ] }, { "resourceType": "Observation", "id": "dv-792db6807e1f4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1033999 } } } ] }, { "resourceType": "Observation", "id": "dv-5a7426725c754", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1040730 } } } ] }, { "resourceType": "Observation", "id": "dv-943634ef64ad4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1046914 } } } ] }, { "resourceType": "Observation", "id": "dv-db1c5de678e64", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "CA" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1055404 } } } ] }, { "resourceType": "Observation", "id": "dv-9b791e715cc74", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "AG" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1061397 } } } ] }, { "resourceType": "Observation", "id": "dv-2ffa9d6e8bab4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1062638 } } } ] }, { "resourceType": "Observation", "id": "dv-8851a1b548a14", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1063044 } } } ] }, { "resourceType": "Observation", "id": "dv-0333d0d259134", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1063241 } } } ] }, { "resourceType": "Observation", "id": "dv-8319b644c7b04", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1064535 } } } ] }, { "resourceType": "Observation", "id": "dv-c071c64aaba74", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1064670 } } } ] }, { "resourceType": "Observation", "id": "dv-3f808171082d4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1064802 } } } ] }, { "resourceType": "Observation", "id": "dv-85a519eebed94", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1064979 } } } ] }, { "resourceType": "Observation", "id": "dv-903dda54cc834", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1065296 } } } ] }, { "resourceType": "Observation", "id": "dv-a870d42d22784", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1066259 } } } ] }, { "resourceType": "Observation", "id": "dv-05b3d5c862854", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1066282 } } } ] }, { "resourceType": "Observation", "id": "dv-efa7d232adc84", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "CT" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1066388 } } } ] }, { "resourceType": "Observation", "id": "dv-6ae49a70a6f24", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1066403 } } } ] }, { "resourceType": "Observation", "id": "dv-3f37a643581d4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1066819 } } } ] }, { "resourceType": "Observation", "id": "dv-450e0a9081004", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1066828 } } } ] }, { "resourceType": "Observation", "id": "dv-2fb2d9423da14", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1066946 } } } ] }, { "resourceType": "Observation", "id": "dv-c70d801145974", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "AT" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "GC" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1066952 } } } ] }, { "resourceType": "Observation", "id": "dv-512deb57ab594", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "CAG" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1067596 } } } ] }, { "resourceType": "Observation", "id": "dv-cc67f80450c84", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "TGG" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1067674 } } } ] }, { "resourceType": "Observation", "id": "dv-b6fded32ba994", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1067862 } } } ] }, { "resourceType": "Observation", "id": "dv-a886923b25154", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1067865 } } } ] }, { "resourceType": "Observation", "id": "dv-589d585bad754", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "GT" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1068669 } } } ] }, { "resourceType": "Observation", "id": "dv-b8508d5976034", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "CGCCGCCTGCCTGCCCG" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1068832 } } } ] }, { "resourceType": "Observation", "id": "dv-c9d489c825134", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1069425 } } } ] }, { "resourceType": "Observation", "id": "dv-30602fd3cd604", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1069443 } } } ] }, { "resourceType": "Observation", "id": "dv-c536ca79a2164", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1069451 } } } ] }, { "resourceType": "Observation", "id": "dv-488f341fb82a4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "AAAAAAAG" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1069475 } } } ] }, { "resourceType": "Observation", "id": "dv-8f7537d15d5b4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1070128 } } } ] }, { "resourceType": "Observation", "id": "dv-4e0b654477914", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1070441 } } } ] }, { "resourceType": "Observation", "id": "dv-10cdc51cde484", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1071118 } } } ] }, { "resourceType": "Observation", "id": "dv-ecc3278ba5d54", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1071192 } } } ] }, { "resourceType": "Observation", "id": "dv-d885ce85d3144", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1072498 } } } ] }, { "resourceType": "Observation", "id": "dv-4a6921b3c65c4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1077064 } } } ] }, { "resourceType": "Observation", "id": "dv-12cc0021fb3f4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1077962 } } } ] }, { "resourceType": "Observation", "id": "dv-1ce524d4e45d4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1080286 } } } ] }, { "resourceType": "Observation", "id": "dv-5941fc5d1f2f4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "TCTGACCTCATGGCCGACCCCAC" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1080927 } } } ] }, { "resourceType": "Observation", "id": "dv-30a3237cdfd64", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1083567 } } } ] }, { "resourceType": "Observation", "id": "dv-bff1caa006164", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1087683 } } } ] }, { "resourceType": "Observation", "id": "dv-82cffd584dde4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1087813 } } } ] }, { "resourceType": "Observation", "id": "dv-8d7c3b41deb14", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1089262 } } } ] }, { "resourceType": "Observation", "id": "dv-932b302e77ee4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1090010 } } } ] }, { "resourceType": "Observation", "id": "dv-e9a298c465b74", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "CT" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1090269 } } } ] }, { "resourceType": "Observation", "id": "dv-734a8b76f6c14", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1090577 } } } ] }, { "resourceType": "Observation", "id": "dv-3738d4de20ea4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1092599 } } } ] }, { "resourceType": "Observation", "id": "dv-e0d69b7a934e4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1094485 } } } ] }, { "resourceType": "Observation", "id": "dv-52b6ed7a35774", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1094672 } } } ] }, { "resourceType": "Observation", "id": "dv-708e6dd006604", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1094738 } } } ] }, { "resourceType": "Observation", "id": "dv-eb00e14fca454", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1094979 } } } ] }, { "resourceType": "Observation", "id": "dv-4fc477778f1b4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1095383 } } } ] }, { "resourceType": "Observation", "id": "dv-4aa61f8667554", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1095619 } } } ] }, { "resourceType": "Observation", "id": "dv-59aabf8d19f74", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1096011 } } } ] }, { "resourceType": "Observation", "id": "dv-9f6e0e12014d4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1096198 } } } ] }, { "resourceType": "Observation", "id": "dv-45915927d30c4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1096908 } } } ] }, { "resourceType": "Observation", "id": "dv-0e95974dd2074", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1097092 } } } ] }, { "resourceType": "Observation", "id": "dv-5b6fe8f47f564", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1097100 } } } ] }, { "resourceType": "Observation", "id": "dv-cfd9215d79114", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1097287 } } } ] }, { "resourceType": "Observation", "id": "dv-fec95107efad4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1097335 } } } ] }, { "resourceType": "Observation", "id": "dv-bdca3cfa05df4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "CCCCA" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1097407 } } } ] }, { "resourceType": "Observation", "id": "dv-182176a3eea34", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6705-3", "display": "homozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1097937 } } } ] }, { "resourceType": "Observation", "id": "dv-c8130140024a4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1098421 } } } ] }, { "resourceType": "Observation", "id": "dv-435f5b1719d24", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "G" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1098714 } } } ] }, { "resourceType": "Observation", "id": "dv-ba55120741dd4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "TC" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "T" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1098820 } } } ] }, { "resourceType": "Observation", "id": "dv-532f1fd275b74", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-variant" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "69548-6", "display": "Genetic variant assessment" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA9633-4", "display": "Present" } ] }, "component": [ { "code": { "coding": [ { "system": "http://loinc.org", "code": "62374-4", "display": "Human reference sequence assembly version" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA14029-5", "display": "GRCh37" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "48013-7", "display": "Genomic reference sequence ID" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://www.ncbi.nlm.nih.gov/nuccore", "code": "NC_000001.10" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "53034-5", "display": "Allelic state" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "LA6706-1", "display": "heterozygous" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69547-8", "display": "Genomic Ref allele" } ] }, "valueString": "A" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "69551-0", "display": "Genomic Alt allele" } ] }, "valueString": "C" }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "tbd-coordinate system", "display": "Genomic coordinate system" } ] }, "valueCodeableConcept": { "coding": [ { "system": "http://hl7.org/fhir/uv/genomics-reporting/CodeSystem/genetic-coordinate-system", "code": "1" } ] } }, { "code": { "coding": [ { "system": "http://loinc.org", "code": "81254-5", "display": "Genomic Allele start-end" } ] }, "valueRange": { "low": { "value": 1099342 } } } ] }, { "resourceType": "Observation", "id": "sid-1b53ea3178f24", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-sequence-phase-reltn" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "82120-7", "display": "Sequence phase relationship" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "TBD-cisTrans", "display": "Cis" } ] } }, { "resourceType": "Observation", "id": "sid-7fd563629c9f4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-sequence-phase-reltn" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "82120-7", "display": "Sequence phase relationship" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "TBD-cisTrans", "display": "Cis" } ] } }, { "resourceType": "Observation", "id": "sid-a97acfc033a64", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-sequence-phase-reltn" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "82120-7", "display": "Sequence phase relationship" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "TBD-cisTrans", "display": "Cis" } ] } }, { "resourceType": "Observation", "id": "sid-37fb1fdcd89d4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-sequence-phase-reltn" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "82120-7", "display": "Sequence phase relationship" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "TBD-cisTrans", "display": "Cis" } ] } }, { "resourceType": "Observation", "id": "sid-20c3fde8e3184", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-sequence-phase-reltn" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "82120-7", "display": "Sequence phase relationship" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "TBD-cisTrans", "display": "Cis" } ] } }, { "resourceType": "Observation", "id": "sid-cf5c18eabc6b4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-sequence-phase-reltn" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "82120-7", "display": "Sequence phase relationship" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "TBD-cisTrans", "display": "Cis" } ] } }, { "resourceType": "Observation", "id": "sid-26087faa1e644", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-sequence-phase-reltn" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "82120-7", "display": "Sequence phase relationship" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "TBD-cisTrans", "display": "Cis" } ] } }, { "resourceType": "Observation", "id": "sid-6df62c3a68744", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-sequence-phase-reltn" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "82120-7", "display": "Sequence phase relationship" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "TBD-cisTrans", "display": "Cis" } ] } }, { "resourceType": "Observation", "id": "sid-d1b4ecbb15c74", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-sequence-phase-reltn" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "82120-7", "display": "Sequence phase relationship" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "TBD-cisTrans", "display": "Cis" } ] } }, { "resourceType": "Observation", "id": "sid-9bafd1fc01444", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-sequence-phase-reltn" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "82120-7", "display": "Sequence phase relationship" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "TBD-cisTrans", "display": "Cis" } ] } }, { "resourceType": "Observation", "id": "sid-e60a17fa70af4", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-sequence-phase-reltn" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "82120-7", "display": "Sequence phase relationship" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "TBD-cisTrans", "display": "Cis" } ] } }, { "resourceType": "Observation", "id": "sid-d03d738825c04", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-sequence-phase-reltn" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "82120-7", "display": "Sequence phase relationship" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "TBD-cisTrans", "display": "Cis" } ] } }, { "resourceType": "Observation", "id": "sid-5311f68cfd714", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-sequence-phase-reltn" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "82120-7", "display": "Sequence phase relationship" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "TBD-cisTrans", "display": "Cis" } ] } }, { "resourceType": "Observation", "id": "sid-541cd2dba7154", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-sequence-phase-reltn" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "82120-7", "display": "Sequence phase relationship" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "TBD-cisTrans", "display": "Cis" } ] } }, { "resourceType": "Observation", "id": "sid-1784aaf6a0204", "meta": { "profile": [ "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-sequence-phase-reltn" ] }, "status": "final", "category": { "coding": [ { "system": "http://terminology.hl7.org/CodeSystem/observation-category", "code": "laboratory" } ] }, "code": { "coding": [ { "system": "http://loinc.org", "code": "82120-7", "display": "Sequence phase relationship" } ] }, "subject": { "reference": "Patient/HG00403" }, "valueCodeableConcept": { "coding": [ { "system": "http://loinc.org", "code": "TBD-cisTrans", "display": "Cis" } ] } } ], "status": "final", "code": { "coding": [ { "system": "http://loinc.org", "code": "51969-4", "display": "Genetic analysis report" } ] }, "subject": { "reference": "Patient/HG00403" }, "issued": "2019-12-10T00:43:45+00:00", "result": [ { "reference": "#rs-5d347a24bc0a4" }, { "reference": "#dv-3200606eb98d4" }, { "reference": "#dv-58875111fcbe4" }, { "reference": "#dv-e3a089d351fc4" }, { "reference": "#dv-393ecd6d84df4" }, { "reference": "#dv-3e702b54971f4" }, { "reference": "#dv-544193a40e774" }, { "reference": "#dv-e748c095853f4" }, { "reference": "#dv-97b60ebede6f4" }, { "reference": "#dv-fa623514bf8e4" }, { "reference": "#dv-c7b38dc5dbbd4" }, { "reference": "#dv-9da4b36541e74" }, { "reference": "#dv-21c6c9d6afa74" }, { "reference": "#dv-699861f1403f4" }, { "reference": "#dv-74c04a452e8c4" }, { "reference": "#dv-40981df660244" }, { "reference": "#dv-7f584d631af94" }, { "reference": "#dv-a0fa537759194" }, { "reference": "#dv-ff18e1cb8ffc4" }, { "reference": "#dv-e1260b4cc1944" }, { "reference": "#dv-89af751239904" }, { "reference": "#dv-47ea53c0d23c4" }, { "reference": "#dv-8b7e3d7de98a4" }, { "reference": "#dv-1daa1fbfdce24" }, { "reference": "#dv-7423d31d77f74" }, { "reference": "#dv-639c27a037334" }, { "reference": "#dv-fbc78fc375bd4" }, { "reference": "#dv-61b08dcb75014" }, { "reference": "#dv-a13f0f4fe0844" }, { "reference": "#dv-4b5a3030ac644" }, { "reference": "#dv-2ae2224e99e94" }, { "reference": "#dv-11b797f89e3f4" }, { "reference": "#dv-03e764a619544" }, { "reference": "#dv-11e33402a10e4" }, { "reference": "#dv-97ac8f8d14a04" }, { "reference": "#dv-6f740688b0214" }, { "reference": "#dv-c0aa6bdf40bf4" }, { "reference": "#dv-7a3934afafe94" }, { "reference": "#dv-993bfee3795b4" }, { "reference": "#dv-f742a271defc4" }, { "reference": "#dv-a4b6a61c9c584" }, { "reference": "#dv-aa7f058812794" }, { "reference": "#dv-b57f9bb6a23a4" }, { "reference": "#dv-2882112c295a4" }, { "reference": "#dv-1d2ed1293f524" }, { "reference": "#dv-de74422f2aad4" }, { "reference": "#dv-c92e96f139024" }, { "reference": "#dv-66c24692a5cf4" }, { "reference": "#dv-792db6807e1f4" }, { "reference": "#dv-5a7426725c754" }, { "reference": "#dv-943634ef64ad4" }, { "reference": "#dv-db1c5de678e64" }, { "reference": "#dv-9b791e715cc74" }, { "reference": "#dv-2ffa9d6e8bab4" }, { "reference": "#dv-8851a1b548a14" }, { "reference": "#dv-0333d0d259134" }, { "reference": "#dv-8319b644c7b04" }, { "reference": "#dv-c071c64aaba74" }, { "reference": "#dv-3f808171082d4" }, { "reference": "#dv-85a519eebed94" }, { "reference": "#dv-903dda54cc834" }, { "reference": "#dv-a870d42d22784" }, { "reference": "#dv-05b3d5c862854" }, { "reference": "#dv-efa7d232adc84" }, { "reference": "#dv-6ae49a70a6f24" }, { "reference": "#dv-3f37a643581d4" }, { "reference": "#dv-450e0a9081004" }, { "reference": "#dv-2fb2d9423da14" }, { "reference": "#dv-c70d801145974" }, { "reference": "#dv-512deb57ab594" }, { "reference": "#dv-cc67f80450c84" }, { "reference": "#dv-b6fded32ba994" }, { "reference": "#dv-a886923b25154" }, { "reference": "#dv-589d585bad754" }, { "reference": "#dv-b8508d5976034" }, { "reference": "#dv-c9d489c825134" }, { "reference": "#dv-30602fd3cd604" }, { "reference": "#dv-c536ca79a2164" }, { "reference": "#dv-488f341fb82a4" }, { "reference": "#dv-8f7537d15d5b4" }, { "reference": "#dv-4e0b654477914" }, { "reference": "#dv-10cdc51cde484" }, { "reference": "#dv-ecc3278ba5d54" }, { "reference": "#dv-d885ce85d3144" }, { "reference": "#dv-4a6921b3c65c4" }, { "reference": "#dv-12cc0021fb3f4" }, { "reference": "#dv-1ce524d4e45d4" }, { "reference": "#dv-5941fc5d1f2f4" }, { "reference": "#dv-30a3237cdfd64" }, { "reference": "#dv-bff1caa006164" }, { "reference": "#dv-82cffd584dde4" }, { "reference": "#dv-8d7c3b41deb14" }, { "reference": "#dv-932b302e77ee4" }, { "reference": "#dv-e9a298c465b74" }, { "reference": "#dv-734a8b76f6c14" }, { "reference": "#dv-3738d4de20ea4" }, { "reference": "#dv-e0d69b7a934e4" }, { "reference": "#dv-52b6ed7a35774" }, { "reference": "#dv-708e6dd006604" }, { "reference": "#dv-eb00e14fca454" }, { "reference": "#dv-4fc477778f1b4" }, { "reference": "#dv-4aa61f8667554" }, { "reference": "#dv-59aabf8d19f74" }, { "reference": "#dv-9f6e0e12014d4" }, { "reference": "#dv-45915927d30c4" }, { "reference": "#dv-0e95974dd2074" }, { "reference": "#dv-5b6fe8f47f564" }, { "reference": "#dv-cfd9215d79114" }, { "reference": "#dv-fec95107efad4" }, { "reference": "#dv-bdca3cfa05df4" }, { "reference": "#dv-182176a3eea34" }, { "reference": "#dv-c8130140024a4" }, { "reference": "#dv-435f5b1719d24" }, { "reference": "#dv-ba55120741dd4" }, { "reference": "#dv-532f1fd275b74" }, { "reference": "#sid-1b53ea3178f24" }, { "reference": "#sid-7fd563629c9f4" }, { "reference": "#sid-a97acfc033a64" }, { "reference": "#sid-37fb1fdcd89d4" }, { "reference": "#sid-20c3fde8e3184" }, { "reference": "#sid-cf5c18eabc6b4" }, { "reference": "#sid-26087faa1e644" }, { "reference": "#sid-6df62c3a68744" }, { "reference": "#sid-d1b4ecbb15c74" }, { "reference": "#sid-9bafd1fc01444" }, { "reference": "#sid-e60a17fa70af4" }, { "reference": "#sid-d03d738825c04" }, { "reference": "#sid-5311f68cfd714" }, { "reference": "#sid-541cd2dba7154" }, { "reference": "#sid-1784aaf6a0204" } ] }